Mac-MIR162b

Basic info.

Secondary strurture and sequence

mature sequence    star sequence
5'



3'
AAGAAA       ----    T     C    C            TTT    -  CCTTGTTGGATTTGGTTCTGATCT
      GAAAGGT    GATG CTGGA GCAG GGTTTATCGATC   TCCT GG                        
      |||||||    |||| ||||| |||| ||||||||||||   |||| ||                         
      CTTTCCA    TTGT GGCCT CGTC CCAAATAGCTGG   TAAG TC                        
 TCGCA       ATGT    -     A    T            --C    G  GAAACGTGGGAGCTTGAGGGTTGG

miRNA cluster info.

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID psRNAtarget RNAhybrid PARE-Seq?

The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.

GSMUA_Achr2T19780_001 1.5 NA NA

Mature miRNA conservation

?

Mature miRNA conservation

    Link

    Reference