PmiREN: Plant microRNA Encyclopedia

Mac-MIR169f

Basic info.

miRNA locus ID
Mac-MIR169f

miRNA locus accession
PmiREN012100

Organism
Musa acuminata

Genomic location
Mac-chr5 25042338 25042481 -

Comments
A member of family MIR169

Confidence level

Secondary strurture and sequence

mature sequence star sequence

5'

3'

    GAG  T     CAC                            ------GA   TACTCATGCATGTTCATCTTG
       GA GAGGT   AGTGTGTAGCCAAGGATGACTTGCCGGC        GCT                     
       || |||||   ||||||||||||||||||||||||||||        |||                      
       CT CTCCG   TTGTACATCGGTTTTTGCTGAACGGCCG        TGC                     
TACTATT  T     --T                            GAAATTGT   CACGCACGATGATGACGATAA

Get mature sequence
Get star sequence
Get miRNA stem-loop seqence
Get miRNA stem-loop ± 20bp
Get dot-bracket miRNA secondary structure
Get miRNA stem-loop ± 500bp
Get miRNA Promoter

miRNA cluster info.

Cluster ID:
Chromosome:
Cluster start:
Cluster end:

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID	psRNAtarget	RNAhybrid	PARE-Seq? The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.
GSMUA_Achr8T16690_001	2.0	NA	NA

Mature miRNA conservation

Link

No link
No link

Reference

>Identification and characterization of miRNA169 family members in banana (Musa acuminata L.) that respond to fusarium oxysporum f. sp. cubense infection in banana cultivars. PeerJ, 2018