Pvi-MIR167u

Basic info.

Secondary strurture and sequence

mature sequence    star sequence
5'



3'
 TGA       -  A  T            - -              TCGTGTGGGG   ---     CTAAAGCGATGCCGTGGCATGGCATGGCG
    GTGCCCA AG GA AGAGTGAAGCTG C CAGCATGATCTAAC          GGC   GCAAA                             
    ||||||| || || |||||||||||| | ||||||||||||||          |||   |||||                              
    CACGGGT TC CT TCTCACTTTGAC G GTCGTACTAGATTG          TGG   CGGGT                             
GCTG       C  C  T            A T              ----------   TGG     TTTTATTCGGAGTCGATCGCGTCGTTGGA

miRNA cluster info.

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID psRNAtarget RNAhybrid PARE-Seq?

The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.

Pavir.4NG178100.1 2.0 NA NA
Pavir.9NG197900.1 2.0 1 NA

Mature miRNA conservation

?

Mature miRNA conservation

    Link

    Reference