Zos-MIR858

Basic info.

Secondary strurture and sequence

mature sequence    star sequence
5'



3'
ATCGATCT        A   -----     A         TAA   A  G    GCTTC    -----A   AGCCGGGTGAGTAGTTGCCA
        ATACATGT AGT     AGGTT GAACAGATA   GAA GA AAGA     CTGC      GCC                    
        |||||||| |||     ||||| |||||||||   ||| || ||||     ||||      |||                     
        TATGTACG TCA     TCCAG CTTGTCTGT   CTT CT TTCT     GACG      GAC                    
   CTAAT        C   ATAGT     -         -TG   -  A    AACTA    ATTCTA   AAATGAACTGTTCTTATCAT

miRNA cluster info.

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID psRNAtarget RNAhybrid PARE-Seq?

The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.

Zosma55g00400.1 1.5 NA NA
Zosma170g00120.1 2.0 2 NA
Zosma3g01690.1 2.0 NA NA
Zosma68g00080.1 2.0 2 NA

Mature miRNA conservation

?

Mature miRNA conservation

    Link

    Reference