PmiREN: Plant microRNA Encyclopedia

Pvi-MIR167f

Basic info.

miRNA locus ID
Pvi-MIR167f

miRNA locus accession
PmiREN016351

Organism
Panicum virgatum

Genomic location
Pvi-Chr03K 68715377 68715540 +

Comments
A member of family MIR167

Confidence level

Secondary strurture and sequence

mature sequence star sequence

5'

3'

 AGCG    -     A   T           C              G ----    TATGCTTTATTTTACCTCTCTCCCTGATT
     GTGC TCCAC AGT GGTGAAGCTGC AGCATGATCTGATG T    ATGA                             
     |||| ||||| ||| ||||||||||| |||||||||||||| |    ||||                             G
     CACG GGGTG TCG CTACTTTGATG TCGTACTGGACTGC G    GGAG                             
AGCAA    T     G   T           -              G ATAA    AGAGGGGCTTAGAGACTTAAGCAGGAACC

Get mature sequence
Get star sequence
Get miRNA stem-loop seqence
Get miRNA stem-loop ± 20bp
Get dot-bracket miRNA secondary structure
Get miRNA stem-loop ± 500bp
Get miRNA Promoter

miRNA cluster info.

Cluster ID: 3959
Chromosome: Pvi-Chr03K
Cluster start: 68713607
Cluster end: 68715540

miRNA locus ID	miRNA locus accession	Chromosome	Strand	Start	End
Pvi-MIR167f , Pvi-MIR167p	PmiREN016351, PmiREN016361	Pvi-Chr03K	+	68713607	68715540

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID	psRNAtarget	RNAhybrid	PARE-Seq? The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.
Pavir.4NG178100.1	2.0	NA	NA
Pavir.9NG197900.1	2.0	2	NA

Mature miRNA conservation

Link

No link
No link

Reference

No reference

Pvi-MIR167f

>