Car-MIR171h

Basic info.

Secondary strurture and sequence

mature sequence    star sequence
5'



3'
  GTATGAAGTAGCTATTGTGA       T       C     --    AAAATGTA        TTT
                      TATTGGC TGGTTCA TCAGA  CAAA        ACTTTTTT   
                      ||||||| ||||||| |||||  ||||        ||||||||    
                      ATAACCG GCCGAGT AGTTT  GTTT        TGGAAAAG   
ACTTTTACTTTATCGTAATTCT       T       T     TA    --------        TGT

miRNA cluster info.

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID psRNAtarget RNAhybrid PARE-Seq?

The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.

XM_004506417.2 0.5 NA NA
XM_004515408.2 0.5 NA NA
XM_004515409.2 0.5 NA NA

Mature miRNA conservation

?

Mature miRNA conservation

    Link

    Reference