Gar-MIR171l

Basic info.

Secondary strurture and sequence

mature sequence    star sequence
5'



3'
  ATATTGAGTTGAAATTTTTA            G        TCAAATCT         T
                      TGTTGGCACGGT TAGTCAGA        CTAAATGGC 
                      |||||||||||| ||||||||        ||||||||| G
                      ATAACCGTGCCG GTTAGTCT        GATTTGCTG 
GTCTATACCGCCCAGTTCCACT            A        --------         A

miRNA cluster info.

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID psRNAtarget RNAhybrid PARE-Seq?

The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.

XM_017768217.1 0.5 NA NA
XM_017781711.1 0.5 NA NA
XM_017781712.1 0.5 NA NA
XM_017782901.1 0.5 NA NA
XM_017782902.1 0.5 NA NA
XM_017787403.1 0.5 NA NA

Mature miRNA conservation

?

Mature miRNA conservation

    Link

    Reference