Pha-MIR171d

Basic info.

Secondary strurture and sequence

mature sequence    star sequence
5'



3'
   AA       T  A   AT         T       C    -AAT     GGAGCCATGGCCCATGGATCTGGC
     ATGGAAG GT GCT  GGTGTTGGC CGGCTCA TCAG    CTGCA                        
     ||||||| || |||  ||||||||| ||||||| ||||    |||||                        T
     TACTTTC CA CGA  CTATAACCG GCCGAGT AGTC    CGGTC                        
GTTTG       C  -   CT         T       T    ATTG     CTCGATCGTGACGTCCGACACGGA

miRNA cluster info.

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID psRNAtarget RNAhybrid PARE-Seq?

The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.

PhHAL.9G623900.1 0.0 0 NA
PhHAL.1G329900.1 0.5 NA NA
PhHAL.4G368200.1 0.5 NA NA
PhHAL.7G240100.1 0.5 NA NA
PhHAL.9G407600.1 1.0 NA NA
PhHAL.6G024200.1 1.5 2 NA

Mature miRNA conservation

?

Mature miRNA conservation

    Link

    Reference