PmiREN: Plant microRNA Encyclopedia

Ppe-MIR171d

Basic info.

miRNA locus ID
Ppe-MIR171d

miRNA locus accession
PmiREN017772

Organism
Prunus persica

Genomic location
Ppe-Pp02 29621745 29621910 -

Comments
A member of family MIR171

Confidence level

Secondary strurture and sequence

mature sequence star sequence

5'

3'

TCTGC   A       T   --------                  -A       TATACTTTT    TATATCCATCCATCCATTCATCC
     ACA GTAGACA GGT        GTGATATTGGTTCGGTTC  TATCTTT         TGGA                       
     ||| ||||||| |||        ||||||||||||||||||  |||||||         ||||                       A
     TGT CGTCTGT TCG        CACTATAACTAAGCCGAG  GTAGAAA         TAAG                       
        A       -   TATGTTCT                  CA       --CAAACAC    CACTTCACACTACCTACCTACCT

Get mature sequence
Get star sequence
Get miRNA stem-loop seqence
Get miRNA stem-loop ± 20bp
Get dot-bracket miRNA secondary structure
Get miRNA stem-loop ± 500bp
Get miRNA Promoter

miRNA cluster info.

Cluster ID:
Chromosome:
Cluster start:
Cluster end:

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID	psRNAtarget	RNAhybrid	PARE-Seq? The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.
Prupe.1G501500.1	1.5	1	NA

Mature miRNA conservation

Link

Reference

>Computational identification of microRNAs in peach expressed sequence tags and validation of their precise sequences by miR-RACE. Mol Biol Rep, 2012