PmiREN: Plant microRNA Encyclopedia

Ppe-MIR171e

Basic info.

miRNA locus ID
Ppe-MIR171e

miRNA locus accession
PmiREN017774

Organism
Prunus persica

Genomic location
Ppe-Pp05 13602604 13602716 -

Comments
A member of family MIR171

Confidence level

Secondary strurture and sequence

mature sequence star sequence

5'

3'

TTAGCTAAAAAAATGTGGGA  ----------------------    A                   TCT     G
                    TG                      TTGG ATGGCTCAATCAAATCAAA   CCCAA 
                    ||                      |||| |||||||||||||||||||   ||||| T
                    AC                      AACC TGCCGAGTTAGTTTAGTTT   GGGTT 
                      TTCACTTTTCCGTTGACACTAT    G                   CCT     A

Get mature sequence
Get star sequence
Get miRNA stem-loop seqence
Get miRNA stem-loop ± 20bp
Get dot-bracket miRNA secondary structure
Get miRNA stem-loop ± 500bp
Get miRNA Promoter

miRNA cluster info.

Cluster ID:
Chromosome:
Cluster start:
Cluster end:

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID	psRNAtarget	RNAhybrid	PARE-Seq? The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.
Prupe.3G216900.1	0.0	NA	NA
Prupe.2G138400.1	0.5	NA	NA
Prupe.5G072300.1	0.5	NA	NA

Mature miRNA conservation

Link

Reference

>Computational identification of microRNAs in peach expressed sequence tags and validation of their precise sequences by miR-RACE. Mol Biol Rep, 2012