Sit-MIR171b

Basic info.

Secondary strurture and sequence

mature sequence    star sequence
5'



3'
AGGCC    ---   -- C   --CTT     G  C        TATCAC   GTC  -- TTGCGCCCTATGTCATCAGGA
     AGGG   GCT  C ACT     TGATT AG CGTGCCAA      GTC   GC  G                     
     ||||   |||  | |||     ||||| || ||||||||      |||   ||  |                     T
     TCCC   CGA  G TGA     ACTAG TC GCGCGGTT      TAG   AC  G                     
         ATT   AC T   CCACT     G  T        -TTTTT   ---  TT TCATTCTTGTTACTCTCTGTA

miRNA cluster info.

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID psRNAtarget RNAhybrid PARE-Seq?

The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.

Seita.1G262900.1 0.5 NA NA
Seita.4G003600.1 0.5 NA NA
Seita.9G330300.1 1.0 NA NA
Seita.9G105100.1 1.5 NA NA

Mature miRNA conservation

?

Mature miRNA conservation

    Link

    Reference