Sbi-MIR171d

Basic info.

Secondary strurture and sequence

mature sequence    star sequence
5'



3'
   TA      T    G  AT         T       C     --    CTCTC -  TCCTCAGCTCGTGTCCATTGCGA
     ATGGAA AGTA CT  GATGTTGGC CGGCTCA TCAGA  CCAC     C GA                       
     |||||| |||| ||  ||||||||| ||||||| |||||  ||||     | ||                       C
     TACCTT TCAT GA  CTATAACCG GCCGAGT AGTCT  GGTG     C GG                       
ATATA      C    -  CT         T       T     TT    ----- T  TCGCTGTATATATGTACTAGCTA

miRNA cluster info.

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID psRNAtarget RNAhybrid PARE-Seq?

The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.

SbRio.01G548900.1 0.0 NA NA
SbRio.04G310200.1 0.5 NA NA
SbRio.04G310500.1 0.5 NA NA
SbRio.06G189500.1 0.5 NA NA
SbRio.01G325800.1 1.0 NA NA
SbRio.10G003900.1 1.5 NA NA

Mature miRNA conservation

?

Mature miRNA conservation

    Link

    Reference