OIn-MIR171a

Basic info.

• miRNA locus ID
• OIn-MIR171a

• miRNA locus accession
• PmiREN031093

• Organism
• Oryza sativa ssp. Indica

• Genomic location
• OIn-2  25601480  25601638  -

• Comments
• A member of family MIR171

• Confidence level
• 

Secondary strurture and sequence

  TATTGCTAG        C     T    C               C     ATG  TGGAGATTGGAGAATAATCGTGACG
           CCATGAAC TGTTT GTTG TGGTCATCTAGCTAC CGTGC   CC                         
           |||||||| ||||| |||| ||||||||||||||| |||||   ||                          
           GGTGCTTG ACAAA CGAC ACCAGTAGATTGGTG GCACG   GT                         
TACGTACGCAG        A     -    T               C     --G  TGTCGGTTCTTCGGCTGACGACGTA

• Get mature sequence
• Get star sequence
• Get miRNA stem-loop seqence
• Get miRNA stem-loop ± 20bp
• Get dot-bracket miRNA secondary structure
• Get miRNA stem-loop ± 500bp
• Get miRNA Promoter

miRNA cluster info.

• Cluster ID: 
• Chromosome: 
• Cluster start: 
• Cluster end: 

miRNA syntenic block

Expression info.

Mature miRNA expression [+]

star miRNA expression [+]

Target gene info.[+]

Link

• No link
• No link

Reference

• No reference