PmiREN: Plant microRNA Encyclopedia

Bra-MIR169x

Basic info.

miRNA locus ID
Bra-MIR169x

miRNA locus accession
PmiREN002731

Organism
Brassica rapa

Genomic location
Bra-A08 20152692 20152834 +

Comments
A member of family MIR169

Confidence level

Secondary strurture and sequence

mature sequence star sequence

5'

3'

  AAGAATGAGAAGTTGTGTGG          T    T     -  T  TGAA   TATCTA         TG  CA
                      TAGCCAAGGA GACT GCCTG CG CT    CCA      TCAGAGACT  AT  
                      |||||||||| |||| ||||| || ||    |||      |||||||||  ||   
                      ATCGGTTTCT CTGA CGGAT GC GA    GGT      AGTCTCTGA  TA  
TCCTCTTTCTCTTAACAGACTT          -    -     T  T  --TC   ----TG         CG  CA

Get mature sequence
Get star sequence
Get miRNA stem-loop seqence
Get miRNA stem-loop ± 20bp
Get dot-bracket miRNA secondary structure
Get miRNA stem-loop ± 500bp
Get miRNA Promoter

miRNA cluster info.

Cluster ID:
Chromosome:
Cluster start:
Cluster end:

No miRNA locus in ± 10k bp interval.

miRNA syntenic block

Syntenic block ID	miRNA locus 1	miRNA locus 1 position	Organism	miRNA locus 2	miRNA locus 2 position
SY-213	Aly-MIR169h	Aly-scaffold_1: 8198500-8198645 -	Brassica rapa	Bra-MIR169x	Bra-A08: 20152692-20152834 +
SY-572	Ath-MIR169h	Ath-Chr1: 6695442-6695584 -	Brassica rapa	Bra-MIR169x	Bra-A08: 20152692-20152834 +
SY-1032	Bra-MIR169n	Bra-A06: 7754638-7754773 -	Brassica rapa	Bra-MIR169x	Bra-A08: 20152692-20152834 +
SY-1040	Bra-MIR169x	Bra-A08: 20152692-20152834 +	Brassica rapa	Bra-MIR169o	Bra-A09: 40392906-40393053 +

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID	psRNAtarget	RNAhybrid	PARE-Seq? The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.
Brara.A03216.1	1.0	1	NA
Brara.B02046.1	1.0	NA	NA
Brara.E01518.1	1.0	1	NA
Brara.F00066.1	1.0	NA	NA
Brara.G03156.1	1.0	1	NA
Brara.H00096.1	1.0	1	NA

Mature miRNA conservation

Link

No link
No link

Reference

>Microsynteny and phylogenetic analysis of tandemly organised miRNA families across five members of Brassicaceae reveals complex retention and loss history. Plant Sci, 2016