Ath-MIR156e

Basic info.

• miRNA locus ID
• Ath-MIR156e

• miRNA locus accession
• PmiREN000635

• Organism
• Arabidopsis thaliana

• Genomic location
• Ath-Chr5  3867193  3867330  +

• Comments
• A member of family MIR156

• Confidence level
• 

Secondary strurture and sequence

        T T  A   TAATT   A         -                    GGT   TT     ---    TTT
         G GA AGG     AGG GGTGACAGA AGAGAGTGAGCACACATGGT   TTC  GCATG   CTTT   
         | || |||     ||| ||||||||| ||||||||||||||||||||   |||  |||||   ||||   G
         C CT TCT     TCC CCACTGTCT TCTCTCATTCGTGTGTATCG   AAG  CGTAC   GGGA   
TTTCTCTCT T  C   -----   -         C                    ---   TT     TTT    TTA

• Get mature sequence
• Get star sequence
• Get miRNA stem-loop seqence
• Get miRNA stem-loop ± 20bp
• Get dot-bracket miRNA secondary structure
• Get miRNA stem-loop ± 500bp
• Get miRNA Promoter

miRNA cluster info.

• Cluster ID: 
• Chromosome: 
• Cluster start: 
• Cluster end: 

miRNA syntenic block

Expression info.

Mature miRNA expression [+]

star miRNA expression [+]

Target gene info.[+]

Link

• Link To miRbase
• Link To PNDB

Reference

• >Leaf heteroblasty in Passiflora edulis as revealed by metabolic profiling and expression analyses of the microRNAs miR156 and miR172. Ann Bot, 2019
• >Roles of the GA-mediated SPL Gene Family and miR156 in the Floral Development of Chinese Chestnut (Castanea mollissima). Int J Mol Sci, 2019
• >SPL7 and SPL8 represent a novel flowering regulation mechanism in switchgrass. New Phytol, 2019
• >Tomato floral induction and flower development are orchestrated by the interplay between gibberellin and two unrelated microRNA-controlled modules. New Phytol, 2019
• >miR156/SPL9 Regulates Reactive Oxygen Species Accumulation and Immune Response in Arabidopsis thaliana. Phytopathology, 2019
• >H2A.Z promotes the transcription of MIR156A and MIR156C in Arabidopsis by facilitating the deposition of H3K4me3. Development, 2018
• >miR394 Acts as a Negative Regulator of Arabidopsis Resistance to B. cinerea Infection by Targeting LCR. Front Plant Sci, 2018
• >UV-B radiation delays flowering time through changes in the PRC2 complex activity and miR156 levels in Arabidopsis thaliana. Plant Cell Environ, 2018
• >A Role for the F-Box Protein HAWAIIAN SKIRT in Plant microRNA Function. Plant Physiol, 2018
• >Threshold-dependent repression of SPL gene expression by miR156/miR157 controls vegetative phase change in Arabidopsis thaliana. PLoS Genet, 2018
• >Overexpression of herbaceous peony miR156e-3p improves anthocyanin accumulation in transgenic Arabidopsis thaliana lateral branches. 3 Biotech, 2017
• >Arabidopsis thaliana miRNAs promote embryo pattern formation beginning in the zygote. Dev Biol, 2017
• >MicroRNAs Are Intensively Regulated during Induction of Somatic Embryogenesis in Arabidopsis. Front Plant Sci, 2017
• >Genome-Wide Profiling of Small RNAs and Degradome Revealed Conserved Regulations of miRNAs on Auxin-Responsive Genes during Fruit Enlargement in Peaches. Int J Mol Sci, 2017
• >Azacytidine and miR156 promote rooting in adult but not in juvenile Arabidopsis tissues. J Plant Physiol, 2017
• >Repression of miR156 by miR159 Regulates the Timing of the Juvenile-to-Adult Transition in Arabidopsis. Plant Cell, 2017
• >Heteroblastic Development of Transfer Cells Is Controlled by the microRNA miR156/SPL Module. Plant Physiol, 2017
• >Comparative analysis of molecular and physiological traits between perennial Arabis alpina Pajares and annual Arabidopsis thaliana Sy-0. Sci Rep, 2017
• >Comparative transcriptome investigation of global gene expression changes caused by miR156 overexpression in Medicago sativa. BMC Genomics, 2016
• >Functional and evolutionary analyses of the miR156 and miR529 families in land plants. BMC Plant Biol, 2016
• >miR156 modulates rhizosphere acidification in response to phosphate limitation in Arabidopsis. J Plant Res, 2016
• >Epigenetic Regulation of Vegetative Phase Change in Arabidopsis. Plant Cell, 2016
• >SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 2 controls floral organ development and plant fertility by activating ASYMMETRIC LEAVES 2 in Arabidopsis thaliana. Plant Mol Biol, 2016
• >Regulation of MicroRNA-Mediated Developmental Changes by the SWR1 Chromatin Remodeling Complex. Plant Physiol, 2016
• >Paralogous SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) genes differentially regulate leaf initiation and reproductive phase change in petunia. Planta, 2016
• >Developmental Functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Genes in Arabidopsis thaliana. PLoS Genet, 2016
• >DELAY OF GERMINATION1 (DOG1) regulates both seed dormancy and flowering time through microRNA pathways. Proc Natl Acad Sci, 2016
• >Lipopolysaccharide perception leads to dynamic alterations in the microtranscriptome of Arabidopsis thaliana cells and leaf tissues. BMC Plant Biol, 2015
• >Plant developmental transitions: the role of microRNAs and sugars. Curr Opin Plant Biol, 2015
• >Expression of the floral repressor miRNA156 is positively regulated by the AGAMOUS-like proteins AGL15 and AGL18. Mol Cells, 2015
• >Progressive regulation of sesquiterpene biosynthesis in Arabidopsis and Patchouli (Pogostemon cablin) by the miR156-targeted SPL transcription factors. Mol Plant, 2015
• >Epigenetic control of juvenile-to-adult phase transition by the Arabidopsis SAGA-like complex. Plant J, 2015
• >The role of miR156/SPLs modules in Arabidopsis lateral root development. Plant J, 2015
• >GmmiR156b overexpression delays flowering time in soybean. Plant Mol Biol, 2015
• >Deciphering the Role of POLYCOMB REPRESSIVE COMPLEX1 Variants in Regulating the Acquisition of Flowering Competence in Arabidopsis. Plant Physiol, 2015
• >A virus-based miRNA suppression (VbMS) system for miRNA loss-of-function analysis in plants. Biotechnol J, 2014
• >Temporal control of leaf complexity by miRNA-regulated licensing of protein complexes. Curr Biol, 2014
• >The Arabidopsis Mediator CDK8 module genes CCT (MED12) and GCT (MED13) are global regulators of developmental phase transitions. Development, 2014
• >Genome-wide identification and phylogenetic analysis of the SBP-box gene family in melons. Genet Mol Res, 2014
• >miR168 influences phase transition, leaf epinasty, and fruit development via SlAGO1s in tomato. J Exp Bot, 2014
• >Stress-induced early flowering is mediated by miR169 in Arabidopsis thaliana. J Exp Bot, 2014
• >The role of microRNAs in the control of flowering time. J Exp Bot, 2014
• >Progressive Regulation of Sesquiterpene Biosynthesis in Arabidopsis and Patchouli (Pogostemon cablin) by the miR156-Targeted SPL Transcription Factors. Mol Plant, 2014
• >Arabidopsis miR156 Regulates Tolerance to Recurring Environmental Stress through SPL Transcription Factors. Plant Cell, 2014
• >The miR156-SPL9-DFR pathway coordinates the relationship between development and abiotic stress tolerance in plants. Plant J, 2014
• >Interaction between two timing microRNAs controls trichome distribution in Arabidopsis. PLoS Genet, 2014
• >Multiscale digital Arabidopsis predicts individual organ and whole-organism growth. Proc Natl Acad Sci, 2014
• >Sugar promotes vegetative phase change in Arabidopsis thaliana by repressing the expression of MIR156A and MIR156C. Elife, 2013
• >Generation and analysis of a complete mutant set for the Arabidopsis FT/TFL1 family shows specific effects on thermo-sensitive flowering regulation. J Exp Bot, 2013
• >SPL8 and miR156-targeted SPL genes redundantly regulate Arabidopsis gynoecium differential patterning. Plant J, 2013
• >SPL8 Acts Together with the Brassinosteroid-Signaling Component BIM1 in Controlling Arabidopsis thaliana Male Fertility. Plants, 2013
• >Mechanisms of age-dependent response to winter temperature in perennial flowering of Arabis alpina. Science, 2013
• >Molecular basis of age-dependent vernalization in Cardamine flexuosa. Science, 2013
• >Gradual increase of miR156 regulates temporal expression changes of numerous genes during leaf development in rice. Plant Physiol, 2012
• >Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156-targeted SPL transcription factor. Plant Cell, 2011
• >The COP1 ortholog PPS regulates the juvenile-adult and vegetative-reproductive phase changes in rice. Plant Cell, 2011
• >miRNA control of vegetative phase change in trees. PLoS Genet, 2011
• >miR156-targeted and nontargeted SBP-box transcription factors act in concert to secure male fertility in Arabidopsis. Plant Cell, 2010
• >Orchestration of the floral transition and floral development in Arabidopsis by the bifunctional transcription factor APETALA2. Plant Cell, 2010
• >Temporal control of trichome distribution by microRNA156-targeted SPL genes in Arabidopsis thaliana. Plant Cell, 2010
• >miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana. Cell, 2009
• >The more and smaller cells mutants of Arabidopsis thaliana identify novel roles for SQUAMOSA PROMOTER BINDING PROTEIN-LIKE genes in the control of heteroblasty. Development, 2009
• >Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing. Plant Physiol, 2009
• >Dual effects of miR156-targeted SPL genes and CYP78A5/KLUH on plastochron length and organ size in Arabidopsis thaliana. Plant Cell, 2008
• >Temporal regulation of shoot development in Arabidopsis thaliana by miR156 and its target SPL3. Development, 2006