Ath-MIR166e

Basic info.

• miRNA locus ID
• Ath-MIR166e

• miRNA locus accession
• PmiREN000666

• Organism
• Arabidopsis thaliana

• Genomic location
• Ath-Chr5  16775504  16775676  -

• Comments
• A member of family MIR166

• Confidence level
• 

Secondary strurture and sequence

         TTTTCCTT            TT      CA   G C C      --------T    C    - TTGATTATATATATATGTCT
   TGAAGC        TTGAGGGGAATG  GTCTGG  CGA G C TTAACT         AGAT TATA T                    
   ||||||        ||||||||||||  ||||||  ||| | | ||||||         |||| |||| |                    C
   GCTTCG        AACTCCCCTTAC  CGGACC  GCT C G AATTGG         AGTA AGTA A                    
CTA      -CTATATT            TT      AG   G A T      CATTTTACT    -    C TATCTGATTACTTATTTCTT

• Get mature sequence
• Get star sequence
• Get miRNA stem-loop seqence
• Get miRNA stem-loop ± 20bp
• Get dot-bracket miRNA secondary structure
• Get miRNA stem-loop ± 500bp
• Get miRNA Promoter

miRNA cluster info.

• Cluster ID: 
• Chromosome: 
• Cluster start: 
• Cluster end: 

miRNA syntenic block

Expression info.

Mature miRNA expression [+]

star miRNA expression [+]

Target gene info.[+]

Link

• Link To miRbase
• Link To PNDB

Reference

• >Association of microRNAs with Types of Leaf Curvature in Brassica rapa. Front Plant Sci, 2018
• >Functionally Diversified Members of the MIR165/6 Gene Family Regulate Ovule Morphogenesis in Arabidopsis thaliana. Plant Cell Physiol, 2018
• >Small RNA profiling for identification of miRNAs involved in regulation of saponins biosynthesis in Chlorophytum borivilianum. BMC Plant Biol, 2017
• >Arabidopsis thaliana miRNAs promote embryo pattern formation beginning in the zygote. Dev Biol, 2017
• >Global Analysis of Small RNA Dynamics during Seed Development of Picea glauca and Arabidopsis thaliana Populations Reveals Insights on their Evolutionary Trajectories. Front Plant Sci, 2017
• >MicroRNAs Are Intensively Regulated during Induction of Somatic Embryogenesis in Arabidopsis. Front Plant Sci, 2017
• >Genome-Wide Profiling of Small RNAs and Degradome Revealed Conserved Regulations of miRNAs on Auxin-Responsive Genes during Fruit Enlargement in Peaches. Int J Mol Sci, 2017
• >ARGONAUTE10 Inhibits In Vitro Shoot Regeneration Via Repression of miR165/166 in Arabidopsis thaliana. Plant Cell Physiol, 2017
• >Phytohormonal crosstalk modulates the expression of miR166/165s, target Class III HD-ZIPs, and KANADI genes during root growth in Arabidopsis thaliana. Sci Rep, 2017
• >Differential regulation of meristem size, morphology and organization by the ERECTA, CLAVATA and class III HD-ZIP pathways. Development, 2016
• >Isolation and expression analysis of four HD-ZIP III family genes targeted by microRNA166 in peach. Genet Mol Res, 2015
• >Balanced activity of microRNA166/165 and its target transcripts from the class III homeodomain-leucine zipper family regulates root growth in Arabidopsis thaliana. Plant Cell Rep, 2014
• >Widespread long noncoding RNAs as endogenous target mimics for microRNAs in plants. Plant Physiol, 2013
• >Long-range genomic enrichment, sequencing, and assembly to determine unknown sequences flanking a known microRNA. PLoS One, 2013
• >The N-terminal double-stranded RNA binding domains of Arabidopsis HYPONASTIC LEAVES1 are sufficient for pre-microRNA processing. Plant Cell, 2007