Ath-MIR167b

Basic info.

• miRNA locus ID
• Ath-MIR167b

• miRNA locus accession
• PmiREN000670

• Organism
• Arabidopsis thaliana

• Genomic location
• Ath-Chr3  23406157  23406289  +

• Comments
• A member of family MIR167

• Confidence level
• 

Secondary strurture and sequence

  CAAGTCCACAAGGGAACA     A    - -C           T   T    AA   ATG      GA
                    AGTGA GCTG C  AGCATGATCTA CTT GGTT  GAG   AATGTG  
                    ||||| |||| |  ||||||||||| ||| ||||  |||   ||||||   
                    TCACT CGAC G  TCGTACTGGAT GAA CCAA  TTC   TTATAC  
TACCAGGATTTGGTCCTTCC     C    A TC           C   C    -A   --G      AA

• Get mature sequence
• Get star sequence
• Get miRNA stem-loop seqence
• Get miRNA stem-loop ± 20bp
• Get dot-bracket miRNA secondary structure
• Get miRNA stem-loop ± 500bp
• Get miRNA Promoter

miRNA cluster info.

• Cluster ID: 
• Chromosome: 
• Cluster start: 
• Cluster end: 

miRNA syntenic block

Expression info.

Mature miRNA expression [+]

star miRNA expression [+]

Target gene info.[+]

Link

• Link To miRbase
• Link To PNDB

Reference

• >An Essential Role for miRNA167 in Maternal Control of Embryonic and Seed Development. Plant Physiol, 2019
• >Enhanced Arabidopsis disease resistance against Botrytis cinerea induced by sulfur dioxide. Ecotoxicol Environ Saf, 2018
• >Arabidopsis thaliana miRNAs promote embryo pattern formation beginning in the zygote. Dev Biol, 2017
• >Genome-Wide Profiling of Small RNAs and Degradome Revealed Conserved Regulations of miRNAs on Auxin-Responsive Genes during Fruit Enlargement in Peaches. Int J Mol Sci, 2017
• >Developmental Defects Mediated by the P1/HC-Pro Potyviral Silencing Suppressor Are Not Due to Misregulation of AUXIN RESPONSE FACTOR 8. Plant Physiol, 2016
• >Blue light alters miR167 expression and microRNA-targeted auxin response factor genes in Arabidopsis thaliana plants. Plant Physiol Biochem, 2016
• >Overexpression of AtGRDP2, a novel glycine-rich domain protein, accelerates plant growth and improves stress tolerance. Front Plant Sci, 2015
• >MicroRNA167-Directed Regulation of the Auxin Response Factors GmARF8a and GmARF8b Is Required for Soybean Nodulation and Lateral Root Development. Plant Physiol, 2015
• >Uncovering miRNAs involved in crosstalk between nutrient deficiencies in Arabidopsis. Sci Rep, 2015
• >Down-regulation of AUXIN RESPONSE FACTORS 6 and 8 by microRNA 167 leads to floral development defects and female sterility in tomato. J Exp Bot, 2014
• >The involvement of InMIR167 in the regulation of expression of its target gene InARF8, and their participation in the vegetative and generative development of Ipomoea nil plants. J Plant Physiol, 2014
• >Coordination of flower maturation by a regulatory circuit of three microRNAs. PLoS Genet, 2013
• >Auxin controls Arabidopsis adventitious root initiation by regulating jasmonic acid homeostasis. Plant Cell, 2012
• >IAA-Ala Resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress. Plant Cell, 2012
• >Artificial trans-acting siRNAs confer consistent and effective gene silencing. Plant Physiol, 2008
• >Spatio-temporal accumulation of microRNAs is highly coordinated in developing plant tissues. Plant J, 2006