Ath-MIR169a

Basic info.

• miRNA locus ID
• Ath-MIR169a

• miRNA locus accession
• PmiREN000674

• Organism
• Arabidopsis thaliana

• Genomic location
• Ath-Chr3  4358990  4359222  -

• Comments
• A member of family MIR169

• Confidence level
• 

Secondary strurture and sequence

 AA       -           C                      -----     GA    TCTTTATACTCTATTAAGACAATTTAGTTTCAAACTTTTTTTTTTTTTTTTTTTTGAAGG
   TGTGACG AAAGTAGTGTG AGCCAAGGATGACTTGCCGATT     TAAAT  TCTT                                                            
   ||||||| ||||||||||| ||||||||||||||||||||||     |||||  ||||                                                             
   GCGCTGT TTTCATTGCAC TCGGTTCCTGTTGAACGGCTAG     TGAAA  AAGA                                                            
TAC       G           A                      TACAA     --    AAAACCAAAATATATAGAACATAAAATATGCCTTATTATATAGGATTAAAGAAGGACTTA

• Get mature sequence
• Get star sequence
• Get miRNA stem-loop seqence
• Get miRNA stem-loop ± 20bp
• Get dot-bracket miRNA secondary structure
• Get miRNA stem-loop ± 500bp
• Get miRNA Promoter

miRNA cluster info.

• Cluster ID: 
• Chromosome: 
• Cluster start: 
• Cluster end: 

miRNA syntenic block

Expression info.

Mature miRNA expression [+]

star miRNA expression [+]

Target gene info.[+]

Link

• Link To miRbase
• Link To PNDB

Reference

• >High-throughput sequencing and differential expression analysis of miRNAs in response to Brassinosteroid treatment in Arabidopsis thaliana. Funct Integr Genomics, 2019
• >An integrated omics analysis reveals molecular mechanisms that are associated with differences in seed oil content between Glycine max and Brassica napus. BMC Plant Biol, 2018
• >Ambient temperature regulates the expression of a small set of sRNAs influencing plant development through NF-YA2 and YUC2. Plant Cell Environ, 2018
• >MicroRNAs Are Intensively Regulated during Induction of Somatic Embryogenesis in Arabidopsis. Front Plant Sci, 2017
• >Arabidopsis CLAVATA1 and CLAVATA2 receptors contribute to Ralstonia solanacearum pathogenicity through a miR169-dependent pathway. New Phytol, 2016
• >Microsynteny and phylogenetic analysis of tandemly organised miRNA families across five members of Brassicaceae reveals complex retention and loss history. Plant Sci, 2016
• >Lipopolysaccharide perception leads to dynamic alterations in the microtranscriptome of Arabidopsis thaliana cells and leaf tissues. BMC Plant Biol, 2015
• >Stress-induced early flowering is mediated by miR169 in Arabidopsis thaliana. J Exp Bot, 2014
• >A miR169 isoform regulates specific NF-YA targets and root architecture in Arabidopsis. New Phytol, 2014
• >Identification of nutrient-responsive Arabidopsis and rapeseed microRNAs by comprehensive real-time polymerase chain reaction profiling and small RNA sequencing. Plant Physiol, 2009
• >Uncovering small RNA-mediated responses to phosphate deficiency in Arabidopsis by deep sequencing. Plant Physiol, 2009
• >The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and posttranscriptionally to promote drought resistance. Plant Cell, 2008