PmiREN: Plant microRNA Encyclopedia

Egu-MIR394a

Basic info.

miRNA locus ID
Egu-MIR394a

miRNA locus accession
PmiREN005534

Organism
Erythranthe guttata

Genomic location
Egu-NW_012193250.1 4397456 4397635 +

Comments
A member of family MIR394

Confidence level

Secondary strurture and sequence

mature sequence star sequence

5'

3'

CAAAG  TT   T   G      -      TTC            G T TAT      ----     TT   TTTAATTTGAAGTAAAAGATAAGAA
     GG  TCT ACA AGTTTA TTGGCA   TGTCCACCTCCT C C   ATGGAT    TTCTT  TCT                         
     ||  ||| ||| |||||| ||||||   |||||||||||| | |   ||||||    |||||  |||                          
     TC  AGG TGT TCGAGT AACCGT   ACGGGTGGAGGA G G   TGTCTG    ATTTA  GTG                         
       TT   T   G      C      CAT            G T --T      TTAT     --   AAAAAAAGAAGAAAAATATTAGATC

Get mature sequence
Get star sequence
Get miRNA stem-loop seqence
Get miRNA stem-loop ± 20bp
Get dot-bracket miRNA secondary structure
Get miRNA stem-loop ± 500bp
Get miRNA Promoter

miRNA cluster info.

Cluster ID: 3394
Chromosome: Egu-NW_012193250.1
Cluster start: 4392475
Cluster end: 4397635

miRNA locus ID	miRNA locus accession	Chromosome	Strand	Start	End
Egu-MIR171b , Egu-MIR394a	PmiREN005523, PmiREN005534	Egu-NW_012193250.1	+	4392475	4397635

miRNA syntenic block

No syntenic block.

Expression info.

Mature miRNA expression [+]

Reads per million (RPM)

star miRNA expression [+]

Reads per million (RPM)

Target gene info.[+]

Target gene ID	psRNAtarget	RNAhybrid	PARE-Seq? The first number (from 0-2) indicates the category of CleaveLand4 analysis result while the number in brackets displays the number of degradome libraries which verify the miRNA-target interaction. Click the number to download the selected figure of PARE-Seq reads distribution.
XM_012986685.1	1.0	NA	NA

Mature miRNA conservation

Link

No link
No link

Reference

No reference

Egu-MIR394a

>